Detail of EST/Unigene CA990339 |
Acc. | CA990339 |
Internal Acc. | EST643847 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Pyruvate kinase isozyme A, chloroplastic OS=Ricinus communis E-value=0; Pyruvate kinase isozyme A, chloroplastic OS=Nicotiana tabacum E-value=0; Plastidial pyruvate kinase 1, chloroplastic OS=Arabidopsis thaliana E-value=0; Pyruvate kinase isozyme G, chloroplastic OS=Nicotiana tabacum E-value=1e-55; Plastidial pyruvate kinase 3, chloroplastic OS=Arabidopsis thaliana E-value=2e-54; |
Length | 744 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GESD; |
Sequence | TGATAGTGATATTTCAGTCATTGCAAAGATTGAGAGTATTGATTCACTGAAGAACTTAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00873 pyruvate kinase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00873 pyruvate kinase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00873 pyruvate kinase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00873 pyruvate kinase |
EC | 2.7.1.40 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821870 |
Trichome-related Gene from Literature | N/A |