Detail of EST/Unigene CA990358 |
Acc. | CA990358 |
Internal Acc. | EST643866 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 1-Cys peroxiredoxin OS=Medicago truncatula E-value=0; 1-Cys peroxiredoxin PER1 OS=Triticum aestivum E-value=1e-82; 1-Cys peroxiredoxin A OS=Oryza sativa subsp. japonica E-value=4e-82; 1-Cys peroxiredoxin PER1 OS=Hordeum vulgare E-value=6e-82; Probable 1-Cys peroxiredoxin (Fragment) OS=Bromus secalinus E-value=6e-82; |
Length | 742 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GESD; |
Sequence | CAAGGCAAGATCAAACTCCATCACTTCTGTTCTGATTCATGGACCATTCTCTTCTCTCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K00430 peroxidase; Metabolism > Energy Metabolism > ko00680 Methane metabolism > K00430 peroxidase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00430 peroxidase; Metabolism > Biosynthesis of Secondary Metabolites > ko00960 Alkaloid biosynthesis II > K01066 esterase / lipase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00623 2,4-Dichlorobenzoate degradation > K01066 esterase / lipase |
EC | 1.11.1.15 1.11.1.7 3.1.1.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841231 |
Trichome-related Gene from Literature | N/A |