Detail of EST/Unigene CA990462 |
Acc. | CA990462 |
Internal Acc. | EST643970 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribonucleoside-diphosphate reductase large subunit OS=Arabidopsis thaliana E-value=2e-14; Ribonucleoside-diphosphate reductase large subunit OS=Pongo abelii E-value=2e-07; Ribonucleoside-diphosphate reductase large subunit OS=Homo sapiens E-value=2e-07; Ribonucleoside-diphosphate reductase large subunit OS=Mus musculus E-value=4e-06; |
Length | 472 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GESD; |
Sequence | CCGAACCCGAGCTGCAAGTGACGCCATCAAGTTCACTGTTGATACCTCTGCCATTAAAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K10807 ribonucleoside-diphosphate reductase subunit M1; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K10807 ribonucleoside-diphosphate reductase subunit M1; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K10807 ribonucleoside-diphosphate reductase subunit M1 |
EC | 1.17.4.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816715 |
Trichome-related Gene from Literature | N/A |