Detail of EST/Unigene CA990500 |
Acc. | CA990500 |
Internal Acc. | EST644008 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S2, chloroplastic OS=Lotus japonicus E-value=7e-55; 30S ribosomal protein S2, chloroplastic OS=Pisum sativum E-value=9e-55; 30S ribosomal protein S2, chloroplastic OS=Morus indica E-value=1e-53; 30S ribosomal protein S2, chloroplastic OS=Carica papaya E-value=4e-53; 30S ribosomal protein S2, chloroplastic OS=Ranunculus macranthus E-value=8e-53; |
Length | 389 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GESD; |
Sequence | AAAAACGTGTGGGGATAATGACAAAAGATATTGGAACATAACTTTTGAAGAGATGATGGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |