| Detail of EST/Unigene CA990527 |
| Acc. | CA990527 |
| Internal Acc. | EST644035 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Citrate synthase, glyoxysomal OS=Cucurbita maxima E-value=3e-30; Citrate synthase 2, peroxisomal OS=Arabidopsis thaliana E-value=5e-29; Citrate synthase 3, peroxisomal OS=Arabidopsis thaliana E-value=5e-28; Citrate synthase 1, peroxisomal OS=Arabidopsis thaliana E-value=3e-14; Citrate synthase, peroxisomal OS=Dictyostelium discoideum E-value=2e-12; |
| Length | 234 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GESD; |
| Sequence | CACTATTTTATTTGCTATCCCTCGTATGGCTGGATACTTGGCACATTGGCGGGAGTCCTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825044 |
| Trichome-related Gene from Literature | N/A |