Detail of EST/Unigene CA990729 |
Acc. | CA990729 |
Internal Acc. | EST644237 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L16, chloroplastic OS=Olimarabidopsis pumila E-value=2e-08; 50S ribosomal protein L16, chloroplastic OS=Nasturtium officinale E-value=2e-08; 50S ribosomal protein L16, chloroplastic OS=Lobularia maritima E-value=2e-08; 50S ribosomal protein L16, chloroplastic OS=Lepidium virginicum E-value=2e-08; 50S ribosomal protein L16, chloroplastic OS=Draba nemorosa E-value=2e-08; |
Length | 323 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GESD; |
Sequence | TGGGTAGCTGTCGTTAAACCCGGCTTAATACTTTATGAAATGGGAGGGGTCCCAGAAAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |