| Detail of EST/Unigene CA990847 |
| Acc. | CA990847 |
| Internal Acc. | EST644355 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L16, chloroplastic (Fragment) OS=Vigna unguiculata E-value=1e-49; 50S ribosomal protein L16, chloroplastic OS=Helianthus annuus E-value=2e-49; 50S ribosomal protein L16, chloroplastic OS=Guizotia abyssinica E-value=2e-49; 50S ribosomal protein L16, chloroplastic OS=Eucalyptus globulus subsp. globulus E-value=1e-47; 50S ribosomal protein L16, chloroplastic OS=Cicer arietinum E-value=1e-47; |
| Length | 593 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GESD; |
| Sequence | TTAGAACCTTATATCAAAACAACATTATCTAGTTAGATATGGATAGCAAAAATGGTCTAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |