Detail of EST/Unigene CA990847 |
Acc. | CA990847 |
Internal Acc. | EST644355 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L16, chloroplastic (Fragment) OS=Vigna unguiculata E-value=1e-49; 50S ribosomal protein L16, chloroplastic OS=Helianthus annuus E-value=2e-49; 50S ribosomal protein L16, chloroplastic OS=Guizotia abyssinica E-value=2e-49; 50S ribosomal protein L16, chloroplastic OS=Eucalyptus globulus subsp. globulus E-value=1e-47; 50S ribosomal protein L16, chloroplastic OS=Cicer arietinum E-value=1e-47; |
Length | 593 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GESD; |
Sequence | TTAGAACCTTATATCAAAACAACATTATCTAGTTAGATATGGATAGCAAAAATGGTCTAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |