| Detail of EST/Unigene CA990963 |
| Acc. | CA990963 |
| Internal Acc. | EST644471 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Naringenin,2-oxoglutarate 3-dioxygenase OS=Vitis vinifera E-value=0; Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Petunia hybrida E-value=0; Naringenin,2-oxoglutarate 3-dioxygenase OS=Arabidopsis thaliana E-value=0; Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Matthiola incana E-value=0; Flavanone 3-dioxygenase OS=Petroselinum crispum E-value=0; |
| Length | 700 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GESD; |
| Sequence | CATACCCAATTAGACAAAGAGACTATTCAAGGTGGCCAGACAAGCCAGAAGGATGGAAAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824287 |
| Trichome-related Gene from Literature | 824287 |