| Detail of EST/Unigene CA990987 |
| Acc. | CA990987 |
| Internal Acc. | EST644495 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Putative quinone-oxidoreductase homolog, chloroplastic OS=Arabidopsis thaliana E-value=3e-91; Quinone-oxidoreductase homolog, chloroplastic OS=Spinacia oleracea E-value=2e-88; Reticulon-4-interacting protein 1, mitochondrial OS=Bos taurus E-value=1e-28; Reticulon-4-interacting protein 1, mitochondrial OS=Homo sapiens E-value=5e-28; Reticulon-4-interacting protein 1, mitochondrial OS=Mus musculus E-value=6e-27; |
| Length | 760 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GESD; |
| Sequence | GCGATATAGAAAGATTTATATCACATGGGCTATCAAACTCATGCATGCAGTTCAGTACGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.6.5.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826914 |
| Trichome-related Gene from Literature | N/A |