Detail of EST/Unigene CA991237 |
Acc. | CA991237 |
Internal Acc. | EST644745 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S3, chloroplastic OS=Lotus japonicus E-value=2e-23; 30S ribosomal protein S3, chloroplastic OS=Nicotiana tabacum E-value=9e-23; 30S ribosomal protein S3, chloroplastic OS=Nicotiana tomentosiformis E-value=9e-23; 30S ribosomal protein S3, chloroplastic OS=Nicotiana sylvestris E-value=9e-23; 30S ribosomal protein S3, chloroplastic OS=Ipomoea purpurea E-value=9e-23; |
Length | 566 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GESD; |
Sequence | TAGGAGTTCATAGTACAACATCTGGCGGGACGTATCGACGGAAAAGAAATTGCACGTGTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |