Detail of EST/Unigene CA991366 |
Acc. | CA991366 |
Internal Acc. | EST644874 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L14, chloroplastic OS=Cicer arietinum E-value=1e-35; 50S ribosomal protein L14, chloroplastic OS=Glycine max E-value=1e-34; 50S ribosomal protein L14, chloroplastic OS=Lotus japonicus E-value=3e-34; 50S ribosomal protein L14, chloroplastic OS=Phaseolus vulgaris E-value=6e-34; 50S ribosomal protein L14, chloroplastic OS=Draba nemorosa E-value=6e-34; |
Length | 569 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GESD; |
Sequence | ATATTTCCAGACAAACCTGTTACAGTAAGACCTACCGAAACGCGTATGGGTTCGGGAAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |