Detail of EST/Unigene CA991420 |
Acc. | CA991420 |
Internal Acc. | EST644928 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Vacuolar-sorting receptor 1 OS=Pisum sativum E-value=5e-69; Vacuolar-sorting receptor 4 OS=Arabidopsis thaliana E-value=7e-62; Vacuolar-sorting receptor 3 OS=Arabidopsis thaliana E-value=2e-61; Vacuolar-sorting receptor 1 OS=Arabidopsis thaliana E-value=5e-46; Vacuolar-sorting receptor 2 OS=Arabidopsis thaliana E-value=1e-41; |
Length | 449 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GESD; |
Sequence | GCATTTTCTGCTTGTTTGGATGATGGAGGAGTTAAATGCCAGTGTCCTACAGGGTTTAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04357 epidermal growth factor; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04357 epidermal growth factor; Environmental Information Processing > Signaling Molecules and Interaction > ko04060 Cytokine-cytokine receptor interaction > K04357 epidermal growth factor |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 815960 |
Trichome-related Gene from Literature | N/A |