Detail of EST/Unigene CA991426 |
Acc. | CA991426 |
Internal Acc. | EST644934 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Leucine aminopeptidase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-27; Leucine aminopeptidase 2, chloroplastic OS=Solanum lycopersicum E-value=3e-25; Leucine aminopeptidase 1 OS=Arabidopsis thaliana E-value=3e-24; Leucine aminopeptidase, chloroplastic OS=Solanum tuberosum E-value=4e-22; Leucine aminopeptidase 3, chloroplastic OS=Arabidopsis thaliana E-value=4e-22; |
Length | 430 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GESD; |
Sequence | CTGATATGGTAACACTGGTGGTATACCAGGTGGTTCTATTACTGCTGCTCTTTTCCTGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.4.11.1 3.4.11.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816954 |
Trichome-related Gene from Literature | N/A |