Detail of EST/Unigene CB891223 |
Acc. | CB891223 |
Internal Acc. | EST648192 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chaperonin CPN60-2, mitochondrial OS=Cucurbita maxima E-value=4e-81; Chaperonin CPN60-1, mitochondrial OS=Cucurbita maxima E-value=7e-79; Chaperonin CPN60, mitochondrial OS=Arabidopsis thaliana E-value=1e-78; Chaperonin CPN60-like 1, mitochondrial OS=Arabidopsis thaliana E-value=4e-78; Chaperonin CPN60-1, mitochondrial OS=Zea mays E-value=1e-77; |
Length | 761 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | AGGGTCAAAAAATTATTCAAAATGTTTCAATTATCATTGCAATTGTAATAAAACAATAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821983 |
Trichome-related Gene from Literature | N/A |