Detail of EST/Unigene CB891477 |
Acc. | CB891477 |
Internal Acc. | EST648446 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Pisum sativum E-value=0; Alpha-1,4-glucan-protein synthase [UDP-forming] 2 OS=Solanum tuberosum E-value=0; Alpha-1,4-glucan-protein synthase [UDP-forming] 1 OS=Solanum tuberosum E-value=0; Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Zea mays E-value=0; UDP-arabinopyranose mutase 1 OS=Oryza sativa subsp. japonica E-value=0; |
Length | 702 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | GAGCAGCACATTAAGAATCTCCTCAGTCCATCCACTCCATTTTTCTTCAATACCCTTTAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821233 |
Trichome-related Gene from Literature | N/A |