Detail of EST/Unigene CB891500 |
Acc. | CB891500 |
Internal Acc. | EST648469 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Bifunctional glutamate/proline--tRNA ligase OS=Mus musculus E-value=5e-45; Bifunctional glutamate/proline--tRNA ligase OS=Homo sapiens E-value=6e-45; Proline--tRNA ligase OS=Plasmodium falciparum (isolate 3D7) E-value=8e-45; Putative proline--tRNA ligase C19C7.06 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=8e-42; Bifunctional glutamate/proline--tRNA ligase OS=Drosophila melanogaster E-value=2e-39; |
Length | 639 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | ATTTATAACACAGTGGTTCACGTTTCTTCTTTCCTCCAGCCGAGAATCGCCGGAAACACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K01881 prolyl-tRNA synthetase; Genetic Information Processing > Translation > ko00970 Aminoacyl-tRNA biosynthesis > K01881 prolyl-tRNA synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01885 glutamyl-tRNA synthetase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K01885 glutamyl-tRNA synthetase; Genetic Information Processing > Translation > ko00970 Aminoacyl-tRNA biosynthesis > K01885 glutamyl-tRNA synthetase |
EC | 6.1.1.15 6.1.1.17 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825385 |
Trichome-related Gene from Literature | N/A |