Detail of EST/Unigene CB891650 |
Acc. | CB891650 |
Internal Acc. | EST648619 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chorismate synthase 1, chloroplastic OS=Solanum lycopersicum E-value=5e-36; Chorismate synthase, chloroplastic OS=Arabidopsis thaliana E-value=3e-34; Chorismate synthase 2, chloroplastic OS=Solanum lycopersicum E-value=1e-33; Chorismate synthase, chloroplastic OS=Corydalis sempervirens E-value=1e-30; Chorismate synthase OS=Synechococcus sp. (strain JA-3-3Ab) E-value=6e-21; |
Length | 546 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | TGACACTCTAGAAACAATGTCAACTATTAAAAACGAAGAGAAAAAAGAAAATAGTTTTTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841307 |
Trichome-related Gene from Literature | N/A |