Detail of EST/Unigene CB891774 |
Acc. | CB891774 |
Internal Acc. | EST648743 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Argininosuccinate synthase, chloroplastic OS=Arabidopsis thaliana E-value=5e-87; Argininosuccinate synthase OS=Vibrio harveyi (strain ATCC BAA-1116 / BB120) E-value=6e-64; Argininosuccinate synthase OS=Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633) E-value=2e-63; Argininosuccinate synthase OS=Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR) E-value=3e-63; Argininosuccinate synthase OS=Vibrio vulnificus (strain YJ016) E-value=1e-62; |
Length | 566 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | CTCTATATAAAGACGTAGAAATTTCTGAGACCAAGAAGGTTGCTGGACTAAAAGGTAAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K01940 argininosuccinate synthase; Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K01940 argininosuccinate synthase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01940 argininosuccinate synthase |
EC | 6.3.4.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828586 |
Trichome-related Gene from Literature | N/A |