| Detail of EST/Unigene CB891804 |
| Acc. | CB891804 |
| Internal Acc. | EST648773 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamyl-tRNA(Gln) amidotransferase subunit A, chloroplastic/mitochondrial OS=Arabidopsis thaliana E-value=3e-15; Glutamyl-tRNA(Gln) amidotransferase subunit A, chloroplastic/mitochondrial OS=Vitis vinifera E-value=9e-13; Glutamyl-tRNA(Gln) amidotransferase subunit A, chloroplastic/mitochondrial OS=Zea mays E-value=9e-13; Glutamyl-tRNA(Gln) amidotransferase subunit A, chloroplastic/mitochondrial OS=Sorghum bicolor E-value=9e-13; |
| Length | 297 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3; |
| Sequence | ACAATCACCACTCAAGCTATTCTCACACACCCCCAACCTACCACTGCACCCCCCTCTCAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822154 |
| Trichome-related Gene from Literature | N/A |