| Detail of EST/Unigene CB891810 |
| Acc. | CB891810 |
| Internal Acc. | EST648779 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Delta-1-pyrroline-5-carboxylate dehydrogenase 12A1, mitochondrial OS=Arabidopsis thaliana E-value=0; Probable aldehyde dehydrogenase OS=Linum usitatissimum E-value=0; Methylmalonate semialdehyde dehydrogenase [acylating] 3 OS=Bacillus cereus (strain ZK / E33L) E-value=5e-13; Methylmalonate semialdehyde dehydrogenase [acylating] 2 OS=Bacillus thuringiensis subsp. konkukian (strain 97-27) E-value=1e-12; Methylmalonate semialdehyde dehydrogenase [acylating] 2 OS=Bacillus cereus (strain ZK / E33L) E-value=1e-12; |
| Length | 635 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3; |
| Sequence | TTTGCAAAGCTAATACAGAGAGTTTCTCCAAAGAGTTATCAGCAGGCTTTTGCGGAAGTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00031 Inositol metabolism > K00140 methylmalonate-semialdehyde dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K00140 methylmalonate-semialdehyde dehydrogenase; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K00140 methylmalonate-semialdehyde dehydrogenase |
| EC | 1.2.1.18 1.2.1.27 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836373 |
| Trichome-related Gene from Literature | N/A |