| Detail of EST/Unigene CB891938 |
| Acc. | CB891938 |
| Internal Acc. | EST648907 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Type I inositol 1,4,5-trisphosphate 5-phosphatase 2 OS=Arabidopsis thaliana E-value=9e-17; Type I inositol 1,4,5-trisphosphate 5-phosphatase CVP2 OS=Arabidopsis thaliana E-value=2e-16; Type I inositol 1,4,5-trisphosphate 5-phosphatase 1 OS=Arabidopsis thaliana E-value=1e-12; Type I inositol 1,4,5-trisphosphate 5-phosphatase 13 OS=Arabidopsis thaliana E-value=1e-06; Type II inositol 1,4,5-trisphosphate 5-phosphatase FRA3 OS=Arabidopsis thaliana E-value=3e-06; |
| Length | 732 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3; |
| Sequence | TTCCTCTCCTCTTCAGTCTTTCTCTTCCCTGTAATGATCTCTTCCATTTCTTCTATATAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00562 Inositol phosphate metabolism > K01099 phosphatidylinositol-bisphosphatase; Environmental Information Processing > Signal Transduction > ko04070 Phosphatidylinositol signaling system > K01099 phosphatidylinositol-bisphosphatase |
| EC | 3.1.3.36 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 814721 |
| Trichome-related Gene from Literature | N/A |