Detail of EST/Unigene CB891948 |
Acc. | CB891948 |
Internal Acc. | EST648917 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ketol-acid reductoisomerase, chloroplastic OS=Pisum sativum E-value=1e-92; Ketol-acid reductoisomerase, chloroplastic OS=Arabidopsis thaliana E-value=6e-76; Ketol-acid reductoisomerase, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-74; Ketol-acid reductoisomerase, chloroplastic OS=Spinacia oleracea E-value=3e-71; Ketol-acid reductoisomerase OS=Salinibacter ruber (strain DSM 13855 / M31) E-value=5e-10; |
Length | 671 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | ATCTCCGCCTCTTCCAAAACCCTAACAAAGCCAACCACCACAAGCTTCGCCGCCGCTAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825030 |
Trichome-related Gene from Literature | N/A |