Detail of EST/Unigene CB891980 |
Acc. | CB891980 |
Internal Acc. | EST648949 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Seed linoleate 9S-lipoxygenase-2 OS=Pisum sativum E-value=3e-50; Linoleate 9S-lipoxygenase OS=Lens culinaris E-value=5e-50; Linoleate 9S-lipoxygenase 1 OS=Phaseolus vulgaris E-value=4e-49; Seed linoleate 9S-lipoxygenase-3 OS=Glycine max E-value=6e-49; Seed linoleate 9S-lipoxygenase-2 OS=Glycine max E-value=6e-49; |
Length | 424 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | GAGGCTATTCATTTTGGATTACCATGACGCATTCATGTCATACTTTGAAGTATATAAACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00458 arachidonate 12-lipoxygenase; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00460 arachidonate 15-lipoxygenase; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K00460 arachidonate 15-lipoxygenase |
EC | 1.13.11.31 1.13.11.33 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821808 |
Trichome-related Gene from Literature | N/A |