| Detail of EST/Unigene CB892082 |
| Acc. | CB892082 |
| Internal Acc. | EST649051 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Branched-chain-amino-acid aminotransferase 2, chloroplastic OS=Arabidopsis thaliana E-value=3e-71; Branched-chain-amino-acid aminotransferase 5, chloroplastic OS=Arabidopsis thaliana E-value=4e-67; Branched-chain-amino-acid aminotransferase 3, chloroplastic OS=Arabidopsis thaliana E-value=2e-66; Branched-chain-amino-acid aminotransferase 1, mitochondrial OS=Arabidopsis thaliana E-value=3e-66; Putative branched-chain-amino-acid aminotransferase 7 OS=Arabidopsis thaliana E-value=3e-57; |
| Length | 619 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3; |
| Sequence | ATGTAGTGCTGGCCAAAATTTTGGACATGGACAACTTAATCGGTATGGCAACATAGAACT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00290 Valine, leucine and isoleucine biosynthesis > K00826 branched-chain amino acid aminotransferase; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K00826 branched-chain amino acid aminotransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00770 Pantothenate and CoA biosynthesis > K00826 branched-chain amino acid aminotransferase |
| EC | 2.6.1.42 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837543 |
| Trichome-related Gene from Literature | N/A |