| Detail of EST/Unigene CB892084 |
| Acc. | CB892084 |
| Internal Acc. | EST649053 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Mannosyl-oligosaccharide 1,2-alpha-mannosidase MNS3 OS=Arabidopsis thaliana E-value=4e-45; Endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=2e-14; Endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Rattus norvegicus E-value=6e-14; Endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Mus musculus E-value=8e-13; Mannosyl-oligosaccharide 1,2-alpha-mannosidase MNS1 OS=Arabidopsis thaliana E-value=3e-12; |
| Length | 332 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3; |
| Sequence | ATGGGTATTGATGAAGTTGTTGCCGAAGCAGGATTGTGGGTTGAAGAACACCTTTCTGAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K01230 mannosyl-oligosaccharide alpha-1,2-mannosidase; Metabolism > Glycan Biosynthesis and Metabolism > ko00513 High-mannose type N-glycan biosynthesis > K01230 mannosyl-oligosaccharide alpha-1,2-mannosidase; Metabolism > Glycan Biosynthesis and Metabolism > ko00510 N-Glycan biosynthesis > K01230 mannosyl-oligosaccharide alpha-1,2-mannosidase |
| EC | 3.2.1.113 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839879 |
| Trichome-related Gene from Literature | N/A |