| Detail of EST/Unigene CB892124 |
| Acc. | CB892124 |
| Internal Acc. | EST649093 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Casein kinase I isoform delta-like OS=Arabidopsis thaliana E-value=7e-75; Casein kinase I OS=Eimeria tenella E-value=1e-48; Casein kinase I OS=Toxoplasma gondii E-value=3e-48; Casein kinase I homolog hhp1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=3e-48; Casein kinase I OS=Plasmodium yoelii yoelii E-value=1e-46; |
| Length | 871 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3; |
| Sequence | GAACCCATCAACACATTCCTTACAGGGGAAAATAAGAATTTGACTGGAACTGCAAGATAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04340 Hedgehog signaling pathway > K08957 casein kinase 1, alpha; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K08957 casein kinase 1, alpha; Environmental Information Processing > Signal Transduction > ko04340 Hedgehog signaling pathway > K08959 casein kinase 1, delta |
| EC | 2.7.11.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828716 |
| Trichome-related Gene from Literature | N/A |