Detail of EST/Unigene CB892192 |
Acc. | CB892192 |
Internal Acc. | EST649161 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Acetyl-CoA carboxylase 1 OS=Arabidopsis thaliana E-value=0; Acetyl-CoA carboxylase 2 OS=Arabidopsis thaliana E-value=0; Acetyl-CoA carboxylase 1 OS=Oryza sativa subsp. japonica E-value=0; Acetyl-CoA carboxylase 2 OS=Oryza sativa subsp. japonica E-value=0; Acetyl-CoA carboxylase OS=Dictyostelium discoideum E-value=4e-77; |
Length | 816 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | CGGATCATCAGTGATGGCACATGAATTAAAACTTGAAAGTGGAGAAACCAGATGGGTTAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00061 Fatty acid biosynthesis > K01946 biotin carboxylase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K11262 acetyl-CoA carboxylase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K11262 acetyl-CoA carboxylase; Metabolism > Lipid Metabolism > ko00061 Fatty acid biosynthesis > K11262 acetyl-CoA carboxylase |
EC | 6.3.4.14 6.4.1.2 |
Transcription Factor Family | |
Transporter Classification Family | 3.B.1 Na+-transporting carboxylic acid decarboxylase NaT-DC |
Probeset |
|
Corresponding NCBI Gene | 840521 |
Trichome-related Gene from Literature | 840521 |