| Detail of EST/Unigene CB892209 |
| Acc. | CB892209 |
| Internal Acc. | EST649178 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Flavonoid 3'-monooxygenase OS=Arabidopsis thaliana E-value=3e-26; Flavonoid 3'-monooxygenase OS=Petunia hybrida E-value=2e-25; Cytochrome P450 93A3 OS=Glycine max E-value=1e-24; Cytochrome P450 71B22 OS=Arabidopsis thaliana E-value=2e-24; Cytochrome P450 71A2 OS=Solanum melongena E-value=2e-24; |
| Length | 357 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3; |
| Sequence | CTAGTTGGGTCACATTGTTTGCAACATTTGTCATCCTCCTCCTCTTCAGCCGCCGCCTCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07 |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830693 |
| Trichome-related Gene from Literature | 830693 |