Detail of EST/Unigene CB892234 |
Acc. | CB892234 |
Internal Acc. | EST649203 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Exostosin-like 3 OS=Mus musculus E-value=1e-07; Exostosin-like 3 OS=Homo sapiens E-value=1e-07; Exostosin-2 OS=Mus musculus E-value=4e-07; Exostosin-2 OS=Homo sapiens E-value=5e-07; Exostosin-2 OS=Bos taurus E-value=5e-07; |
Length | 782 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3; |
Sequence | TAGCCAACAGGATCTTCCTCTGTTTCTTCATTTTCTGATCTAACCAATCAAACGGGAATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K02367 glucuronyl/N-acetylglucosaminyl transferase EXT2; Metabolism > Glycan Biosynthesis and Metabolism > ko00534 Heparan sulfate biosynthesis > K02367 glucuronyl/N-acetylglucosaminyl transferase EXT2; Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K02370 alpha-1,4-N-acetylglucosaminyltransferase EXTL3; Metabolism > Glycan Biosynthesis and Metabolism > ko00534 Heparan sulfate biosynthesis > K02370 alpha-1,4-N-acetylglucosaminyltransferase EXTL3 |
EC | 2.4.1.223 2.4.1.224 2.4.1.225 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824749 |
Trichome-related Gene from Literature | N/A |