| Detail of EST/Unigene CB892365 |
| Acc. | CB892365 |
| Internal Acc. | EST649334 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Potassium channel GORK OS=Arabidopsis thaliana E-value=3e-15; Potassium channel KOR1 OS=Oryza sativa subsp. japonica E-value=2e-13; Glutaminase liver isoform, mitochondrial OS=Mus musculus E-value=3e-13; Glutaminase liver isoform, mitochondrial OS=Rattus norvegicus E-value=4e-13; Potassium channel AKT6 OS=Arabidopsis thaliana E-value=7e-13; |
| Length | 818 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3; |
| Sequence | ACAAGAAAAAAATTCAATTCAACGCAAATCATAAACAAATACCAACCCATTTTTCTTCAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01425 glutaminase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01425 glutaminase; Metabolism > Metabolism of Other Amino Acids > ko00471 D-Glutamine and D-glutamate metabolism > K01425 glutaminase |
| EC | 3.1.1.47 3.1.1.5 3.5.1.1 3.5.1.2 |
| Transcription Factor Family | CAMTA |
| Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC |
| Probeset |
|
| Corresponding NCBI Gene | 827630 |
| Trichome-related Gene from Literature | N/A |