| Detail of EST/Unigene CB892479 |
| Acc. | CB892479 |
| Internal Acc. | EST649448 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Phospholipase A1-Ibeta2, chloroplastic OS=Arabidopsis thaliana E-value=4e-54; Phospholipase A(1) DAD1, chloroplastic OS=Arabidopsis thaliana E-value=2e-28; Phospholipase A1-Igamma2, chloroplastic OS=Arabidopsis thaliana E-value=1e-16; Phospholipase A1-Igamma3, chloroplastic OS=Arabidopsis thaliana E-value=2e-16; Phospholipase A1-Igamma1, chloroplastic OS=Arabidopsis thaliana E-value=4e-16; |
| Length | 827 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3; |
| Sequence | TCTCTTACAAGGACGCTGTCTTCACCTCCTCACAAAGTTTCTTCAATTATTTTCTATCAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827388 |
| Trichome-related Gene from Literature | N/A |