| Detail of EST/Unigene CK298734 |
| Acc. | CK298734 |
| Internal Acc. | EST761448 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Threonine synthase 1, chloroplastic OS=Arabidopsis thaliana E-value=4e-09; Threonine synthase, chloroplastic OS=Solanum tuberosum E-value=1e-08; Threonine synthase 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-06; |
| Length | 94 nt |
| Species | Nicotiana benthamiana |
| Belonged EST Libraries | NB_MTISSUE; |
| Sequence | AAATGAACATCCCAGTTGAGTCTGCCTGAGCCATAGCATCCATCAACTCCTCCTCCGTTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829106 |
| Trichome-related Gene from Literature | 829106 |