| Detail of EST/Unigene CK714832 |
| Acc. | CK714832 |
| Internal Acc. | LECAD01H22 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein, chloroplastic OS=Zea mays E-value=0; Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=0; Chlorophyll a-b binding protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; Chlorophyll a-b binding protein, chloroplastic OS=Triticum aestivum E-value=0; |
| Length | 711 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_Seedlings; |
| Sequence | AGGAATAGAAAAATCCATTATATTGTCAACTCATTCACAACAACTTTACATGAAAATTTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822391 |
| Trichome-related Gene from Literature | N/A |