Detail of EST/Unigene CV016251 |
Acc. | CV016251 |
Internal Acc. | tbt_010163 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=4e-52; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=4e-52; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=4e-52; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=1e-50; Chlorophyll a-b binding protein 22L, chloroplastic OS=Petunia sp. E-value=2e-50; |
Length | 508 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_NNT; |
Sequence | CAGCACTACTAGCTTTTTTCTTGATAACCATGGCAGCTGCTACAATGGCTCTTCTTCCCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839870 |
Trichome-related Gene from Literature | 839870 |