| Detail of EST/Unigene CV018960 |
| Acc. | CV018960 |
| Internal Acc. | tbt_002604 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein of LHCII type I, chloroplastic (Fragment) OS=Cucumis sativus E-value=4e-76; Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=2e-75; Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=5e-75; Chlorophyll a-b binding protein 2, chloroplastic OS=Hordeum vulgare E-value=5e-70; Chlorophyll a-b binding protein 1, chloroplastic OS=Zea mays E-value=5e-69; |
| Length | 574 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_NNT; |
| Sequence | GGATAACGACTTTGACTCTCAACAGCAACCTCTCATCACCTCCTGATAAACCAGCAGCTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822391 |
| Trichome-related Gene from Literature | N/A |