| Detail of EST/Unigene CV019004 |
| Acc. | CV019004 |
| Internal Acc. | tbt_005884 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=7e-10; Chlorophyll a-b binding protein 1A, chloroplastic OS=Pyrus pyrifolia E-value=7e-10; Chlorophyll a-b binding protein type 2 member 1A, chloroplastic OS=Pinus sylvestris E-value=7e-10; Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=1e-09; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=1e-09; |
| Length | 207 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_NNT; |
| Sequence | CCATGTACGGAAAGGGCCCATTAGAGAACTTGCTGACCACCTTGCAGACCCGGTTAACAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |