| Detail of EST/Unigene CV019459 |
| Acc. | CV019459 |
| Internal Acc. | tbt_000705 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=3e-63; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=1e-62; Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=7e-60; Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-59; Chlorophyll a-b binding protein 3, chloroplastic OS=Arabidopsis thaliana E-value=7e-59; |
| Length | 543 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_NNT; |
| Sequence | CTCTATTATTCAGCCATCAAAAAACACTTCTTTCTCCTTATAAACCATGGCTGCTTCTAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |