Detail of EST/Unigene CV019978 |
Acc. | CV019978 |
Internal Acc. | tbt_001868 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=2e-45; Chlorophyll a-b binding protein 22L, chloroplastic OS=Petunia sp. E-value=3e-44; Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-42; Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=4e-42; Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=4e-42; |
Length | 375 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_NNT; |
Sequence | GCACTTGGGCATTCAAACCATCAGACACTCACTTTTCTTTCAAATAAAACCATGGCTGCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |