Detail of EST/Unigene CV020519 |
Acc. | CV020519 |
Internal Acc. | tbt_004744 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=5e-32; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=6e-32; Chlorophyll a-b binding protein, chloroplastic OS=Triticum aestivum E-value=6e-32; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=6e-32; Chlorophyll a-b binding protein 3B, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=8e-32; |
Length | 290 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_NNT; |
Sequence | CTTGGCAACCCCAAGCTTGGTCCCATGCGACAAAGCTCTTGGCCATTTGGGCTTGCCAAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822391 |
Trichome-related Gene from Literature | N/A |