| Detail of EST/Unigene CV020685 |
| Acc. | CV020685 |
| Internal Acc. | tbt_001494 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Hordeum vulgare E-value=1e-82; Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=7e-82; Chlorophyll a-b binding protein 2, chloroplastic OS=Glycine max E-value=7e-82; Chlorophyll a-b binding protein type I, chloroplastic OS=Pinus thunbergii E-value=8e-77; Chlorophyll a-b binding protein 48, chloroplastic OS=Zea mays E-value=9e-76; |
| Length | 526 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_NNT; |
| Sequence | GGATATGCTGGACTTCAGCTGATCAGAAACTTTTGCCAAGAACGTGAGTTGGAGGTGATC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835515 |
| Trichome-related Gene from Literature | N/A |