Detail of EST/Unigene CV021627 |
Acc. | CV021627 |
Internal Acc. | tbt_008696 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=3e-35; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=3e-35; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=3e-35; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=6e-35; Chlorophyll a-b binding protein 1D (Fragment) OS=Solanum lycopersicum E-value=6e-35; |
Length | 344 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_NNT; |
Sequence | TTGCTGGTGACTCTCGGTGAGGTTGTTGACCCACTTTACCCTGGTGGTAGCTTCGACCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818006 |
Trichome-related Gene from Literature | N/A |