Detail of EST/Unigene CX528857 |
Acc. | CX528857 |
Internal Acc. | s13dNF01B05MJ041_243781 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Digalactosyldiacylglycerol synthase 1, chloroplastic OS=Lotus japonicus E-value=4e-93; Digalactosyldiacylglycerol synthase 1, chloroplastic OS=Glycine max E-value=3e-90; Digalactosyldiacylglycerol synthase 1, chloroplastic OS=Arabidopsis thaliana E-value=5e-69; Digalactosyldiacylglycerol synthase 2, chloroplastic OS=Arabidopsis thaliana E-value=4e-12; Digalactosyldiacylglycerol synthase 2, chloroplastic OS=Lotus japonicus E-value=8e-12; |
Length | 590 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | GTGAGAGTGAAACTAGGGACTGGGAACCGATTAGGGTTTTGAAAACGAGGATTAAAGAGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820339 |
Trichome-related Gene from Literature | N/A |