| Detail of EST/Unigene CX528857 |
| Acc. | CX528857 |
| Internal Acc. | s13dNF01B05MJ041_243781 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Digalactosyldiacylglycerol synthase 1, chloroplastic OS=Lotus japonicus E-value=4e-93; Digalactosyldiacylglycerol synthase 1, chloroplastic OS=Glycine max E-value=3e-90; Digalactosyldiacylglycerol synthase 1, chloroplastic OS=Arabidopsis thaliana E-value=5e-69; Digalactosyldiacylglycerol synthase 2, chloroplastic OS=Arabidopsis thaliana E-value=4e-12; Digalactosyldiacylglycerol synthase 2, chloroplastic OS=Lotus japonicus E-value=8e-12; |
| Length | 590 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR; |
| Sequence | GTGAGAGTGAAACTAGGGACTGGGAACCGATTAGGGTTTTGAAAACGAGGATTAAAGAGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820339 |
| Trichome-related Gene from Literature | N/A |