| Detail of EST/Unigene CX528863 |
| Acc. | CX528863 |
| Internal Acc. | s13dNF01C03MJ018_243793 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Glycine max E-value=6e-78; Glutathione S-transferase U7 OS=Arabidopsis thaliana E-value=5e-48; Glutathione S-transferase U8 OS=Arabidopsis thaliana E-value=1e-47; Glutathione S-transferase U1 OS=Arabidopsis thaliana E-value=3e-43; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=6e-43; |
| Length | 569 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR; |
| Sequence | CAAAGTCATAGAAAATTTAAGTGTTGCAATGGCTACAAATCAGGAACATGTGAAGCTTTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00643 Styrene degradation > K01800 maleylacetoacetate isomerase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K01800 maleylacetoacetate isomerase |
| EC | 2.5.1.18 5.2.1.2 |
| Transcription Factor Family | |
| Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
| Probeset |
|
| Corresponding NCBI Gene | 817491 |
| Trichome-related Gene from Literature | N/A |