Detail of EST/Unigene CX529120 |
Acc. | CX529120 |
Internal Acc. | s13dNF42B10MJ077_244298 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable phospholipid hydroperoxide glutathione peroxidase 6, mitochondrial OS=Arabidopsis thaliana E-value=3e-47; Probable phospholipid hydroperoxide glutathione peroxidase OS=Nicotiana sylvestris E-value=2e-45; Probable phospholipid hydroperoxide glutathione peroxidase OS=Nicotiana tabacum E-value=3e-45; Probable phospholipid hydroperoxide glutathione peroxidase OS=Gossypium hirsutum E-value=4e-44; Probable phospholipid hydroperoxide glutathione peroxidase OS=Solanum lycopersicum E-value=8e-44; |
Length | 630 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | CACACTCACAATTGTCGGTGGCTCTCAGAACAAAGGTATATACTTTGTAGCACTTTGTGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K05361 phospholipid-hydroperoxide glutathione peroxidase |
EC | 1.11.1.7 1.11.1.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826765 |
Trichome-related Gene from Literature | N/A |