| Detail of EST/Unigene CX529226 |
| Acc. | CX529226 |
| Internal Acc. | s13dNF06F04MJ031_244510 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Non-cyanogenic beta-glucosidase OS=Trifolium repens E-value=1e-43; Cyanogenic beta-glucosidase (Fragment) OS=Trifolium repens E-value=4e-42; Beta-glucosidase 27 OS=Oryza sativa subsp. japonica E-value=1e-39; Beta-glucosidase 24 OS=Oryza sativa subsp. japonica E-value=3e-37; Beta-glucosidase 13 OS=Oryza sativa subsp. japonica E-value=3e-37; |
| Length | 529 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR; |
| Sequence | CTTAGTTATATTTCTTCATAGATATCCCACGGCAGTCCCAATCAATGAGGAATGTGATCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
| EC | 3.2.1.108 3.2.1.21 3.2.1.62 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839196 |
| Trichome-related Gene from Literature | N/A |