Detail of EST/Unigene CX529401 |
Acc. | CX529401 |
Internal Acc. | s13dNF90E08MJ055_244854 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | N-alpha-acetyltransferase 16, NatA auxiliary subunit OS=Homo sapiens E-value=1e-52; N-alpha-acetyltransferase 15, NatA auxiliary subunit OS=Pongo abelii E-value=3e-51; N-alpha-acetyltransferase 15, NatA auxiliary subunit OS=Mus musculus E-value=3e-51; N-alpha-acetyltransferase 15, NatA auxiliary subunit OS=Homo sapiens E-value=3e-51; N-alpha-acetyltransferase 16, NatA auxiliary subunit OS=Mus musculus E-value=9e-49; |
Length | 654 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | GTAGATTCCTCTCCATTGGGTTGGAGTTGAGAAGAGTACTTAAGTAGGGTTGCACGCTGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.3.1.88 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 844381 |
Trichome-related Gene from Literature | N/A |