| Detail of EST/Unigene CX529427 |
| Acc. | CX529427 |
| Internal Acc. | s13dNF90H04MJ032_244906 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Peroxinectin A OS=Dictyostelium discoideum E-value=7e-11; Peroxidasin-like protein OS=Homo sapiens E-value=4e-07; Prostaglandin G/H synthase 2 OS=Gallus gallus E-value=9e-06; |
| Length | 626 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR; |
| Sequence | CACTTGAGAGACACATCTGCCTCTCCTGGGCCTAACAAATCTCCGCCATTAATCAAAGAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K00430 peroxidase; Metabolism > Energy Metabolism > ko00680 Methane metabolism > K00430 peroxidase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00430 peroxidase |
| EC | 1.11.1.7 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821135 |
| Trichome-related Gene from Literature | N/A |