Detail of EST/Unigene CX529567 |
Acc. | CX529567 |
Internal Acc. | s13dNF97G07MJ052_245185 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Pisum sativum E-value=6e-83; Glucan endo-1,3-beta-glucosidase, basic isoform OS=Phaseolus vulgaris E-value=1e-70; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Hevea brasiliensis E-value=1e-53; Lichenase OS=Nicotiana plumbaginifolia E-value=3e-53; Glucan endo-1,3-beta-glucosidase, basic isoform 2 OS=Solanum tuberosum E-value=7e-52; |
Length | 573 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | GCAAATCCTTCTTTCATATTCATTTTTAGTGTATACTTTATTTTGCATCATACCTTCTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827320 |
Trichome-related Gene from Literature | N/A |