Detail of EST/Unigene CX529789 |
Acc. | CX529789 |
Internal Acc. | s13dNF52H09MJ077_245623 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | NifU-like protein 2, chloroplastic OS=Arabidopsis thaliana E-value=9e-71; NifU-like protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-60; NifU-like protein 3, chloroplastic OS=Arabidopsis thaliana E-value=1e-53; NifU-like protein 1, chloroplastic OS=Arabidopsis thaliana E-value=8e-22; Putative nitrogen fixation protein YutI OS=Bacillus subtilis (strain 168) E-value=1e-16; |
Length | 597 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | TGTTTTTTGGTACCAATCTTCCTTTTAGGTCAACTAGTAACAACCACCTTCTGCCGCCTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835057 |
Trichome-related Gene from Literature | N/A |