Detail of EST/Unigene CX530496 |
Acc. | CX530496 |
Internal Acc. | s13dNF43A08MJ054_247022 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Uroporphyrinogen decarboxylase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-11; Uroporphyrinogen decarboxylase 1, chloroplastic OS=Arabidopsis thaliana E-value=8e-11; Uroporphyrinogen decarboxylase 2, chloroplastic OS=Arabidopsis thaliana E-value=9e-07; Uroporphyrinogen decarboxylase, chloroplastic OS=Zea mays E-value=1e-06; Uroporphyrinogen decarboxylase (Fragment) OS=Hordeum vulgare E-value=1e-06; |
Length | 413 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | ATCAACAAATAAATAACAATTTTTTTTTATTATACTCAAACAAATAGAAGGAATCCTCTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820722 |
Trichome-related Gene from Literature | N/A |